Cardiology Research, ISSN 1923-2829 print, 1923-2837 online, Open Access
Article copyright, the authors; Journal compilation copyright, Cardiol Res and Elmer Press Inc
Journal website https://www.cardiologyres.org

Original Article

Volume 13, Number 6, December 2022, pages 339-356


Modeling Doxorubicin-Induced Cardiomyopathy With Fibrotic Myocardial Damage in Wistar Rats

Figures

Figure 1.
Figure 1. Experiment scheme. *Weighing points. IP: intraperitoneally.
Figure 2.
Figure 2. Representative images of rat’s left cardiac ventricle of the control, DOX-25, DOX-20.4, and DOX-15 groups. Stained by hematoxylin and eosin, × 50.
Figure 3.
Figure 3. Representative images of rat’s kidney of the control, DOX-25, DOX-20.4, and DOX-15 groups (stained by hematoxylin and eosin, × 25 (control group); × 50 (DOX-25, DOX-20.4, and DOX-15 groups)).
Figure 4.
Figure 4. Dynamics of body weight in animals of the DOX-15, DOX-10, and DOX-5 groups. *Significant differences between the DOX-15 group of animals versus the DOX-10, DOX-5, and control groups (**P < 0.01, ***P < 0.001).
Figure 5.
Figure 5. LVIDs, LVIDd and FS dynamics of animals of the DOX-15, DOX-10, and DOX-5 groups. *Dynamics compared to the initial value (e.g., in the DOX-15 group; *P < 0.05, **P < 0.01, ***P < 0.001). Δ: dynamics compared to the highest dose at each point of the experiment (e.g., in first month: DOX-5, control vs. DOX-15; Δ: P < 0.05, ΔΔ: P < 0.01, ΔΔΔ: P < 0.001). LVIDs: left ventricular end-systolic internal diameter; LVIDd: left ventricular end-diastolic internal diameter; FS: fractional shortening.
Figure 6.
Figure 6. IVS and LVPW dynamics of animals of the DOX-15, DOX-10, and DOX-5 groups. *Dynamics compared to the initial value (*P < 0.05, **P < 0.01, ***P < 0.001). Δ: dynamics compared to the highest dose at each point of the experiment (e.g., in the second month: DOX-10, DOX-5 vs. DOX-15; Δ: P < 0.05, ΔΔ: P < 0.01). IVS: the dimensions of the anterior wall thickness; LVPW: the dimensions of the posterior wall thickness.
Figure 7.
Figure 7. (a) Representative images of rat’s left cardiac ventricle of the control group; × 50; stained by hematoxylin and eosin. (b, c) Representative images of rat’s left cardiac ventricle of the DOX-15 group; stained by hematoxylin and eosin. (b) Dissociation of myocardial fibers is seen, forming cavities filled with blood (arrow); × 50. (c) Asterisks show vacuolization of the cytoplasm of cardiomyocytes, black arrows show nuclei of cardiocytes that undergo karyolysis, white arrows show hypertrophied fibers; × 25. (d) Representative images of rat’s left cardiac ventricle of the DOX-10 group; × 25; stained by hematoxylin and eosin. Anisonucleosis, medium and large cell vacuolization of the cytoplasm (arrows). (e) Representative images of rat’s left cardiac ventricle of the DOX-5 group; × 25; stained by hematoxylin and eosin. The arrows show vacuolization of the cytoplasm of cardiomyocytes, the absence of visible boundaries between individual cells.
Figure 8.
Figure 8. Representative images of rat’s left cardiac ventricle of the control, DOX-15, DOX-10, and DOX-5 groups. Stained by Mallori, collagen is colored blue; × 25.
Figure 9.
Figure 9. The amount of collagen in the left cardiac ventricle with chronic doxorubicin-induced cardiomyopathy of rats of the control, DOX-15, DOX-10, and DOX-5 groups, %. Kruskal-Wallis test.
Figure 10.
Figure 10. (a) Rat’s kidney of the Control group; × 25; stained by hematoxylin and eosin. (b, c) Rat’s kidney of the DOX-15 group; × 25; stained by hematoxylin and eosin. (b) The arrow shows the necrosis of the tubular epithelium, the sclerosed glomerulus shows in the center. (c) Massive tubular epithelial necrosis (arrow). (d) Rat’s kidney of the DOX-10 group; × 50; stained by hematoxylin and eosin. Global glomerulosclerosis of three renal glomeruli. (e) Rat’s kidney of the DOX-5 group; × 25; stained by hematoxylin and eosin. The black arrow shows necrosis of individual tubular epithelial cells. White arrows show thickening of the basement membrane of the glomerulus. Vacuolization of the cells of the parietal leaf of the capsule (asterisk).
Figure 11.
Figure 11. Gene expression levels of fibrotic molecular markers in the model of chronic doxorubicin-induced cardiomyopathy. *P < 0.05, **P < 0.01, ***P < 0.001 compared to control. COL1A1, COL2A1, COL3A1: collagen, type I, II, III; ET-1: endothelin-1; FGF: fibroblast growth factors; MMP: matrix metalloproteinases; TGF-β: transforming growth factor-β; TIMP: tissue inhibitor of metalloprotease; TNF-α: tumor necrosis factor; α-SMA: alpha-smooth muscle actin.

Tables

Table 1. Brief Description of the Experimental Groups
 
Group, nThe route of administrationDoseFrequency of administrationCumulative dose
IP: intraperitoneally.
The first stage - modeling of acute doxorubicin cardiomyopathy
  DOX-25 (n = 10)IP2.5 mg/kgTen times over 1.5 weeks given every day25 mg/kg
  DOX-20.4 (n = 10)IP3.4 mg/kgSix times over 1.5 weeks given every other day20.4 mg/kg
  DOX-15 (n = 10)IP2.5 mg/kgSix times over 1.5 weeks given every other day15 mg/kg
  Control (n = 5)IP1 mL 0.9% sodium chlorideSix times over 1.5 weeks given every other day6 mL
The second stage - modeling of chronic doxorubicin cardiomyopathy
  DOX-15 (n = 10)IP2.5 mg/kgSix times over 2.5 weeks given in 2 days15 mg/kg
  DOX-10 (n = 10)IP1.67 mg/kgSix times over 2.5 weeks given in 2 days10 mg/kg
  DOX-5 (n = 10)IP0.83 mg/kgSix times over 2.5 weeks given in 2 days5 mg/kg
  Control (n = 10)IP1 mL 0.9% sodium chlorideSix times over 2.5 weeks given in 2 days6 mL

 

Table 2. Lists of Primer Sequences Used for RT-qPCR
 
GenesPrimersSequences (5'-3')
α-SMA: alpha-smooth muscle actin; MMP: matrix metalloproteinases; TIMP: tissue inhibitor of metalloprotease; TGF: transforming growth factor; FGF: fibroblast growth factors; TNF: tumor necrosis factor; RT-qPCR: reverse transcription quantitative real time polymerase chain reaction.
ACTA (α-SMA)ForwardCACCGCTGAACGTGAAATTG
ReverseCTTCTCCAGAGAGGAGGAAG
TGF-β1ForwardGACTCTCCACCTGCAAGACC
ReverseGGACTGGCGAGCCTTAGTTT
FGF2ForwardTCCATCAAGGGAGTGTGTGC
ReverseTCCGTGACCGGTAAGTGTTG
FGF4ForwardCTACCTGCTGGGCCTCAAAA
ReverseCACACCCCGCTGCTGTC
Col1a1ForwardGTGGATGGCTGCACGAGTC
ReverseGAGTTTGGGTTGTTGGTCTG
Col2a1ForwardGCTGTGGAAGTGGATGAAGA
ReverseGAGGAACTGTGGAGAGACG
Col3a1ForwardCAGGCCAATGGCAATGTAAAG
ReverseCATCCTCTAGAACTGTGTAAG
TNF-αForwardGGCTCCCTCTCATCAGTTC
ReverseCTGCTTGGTGGTTTGCTAC
ET-1 (endothelin-1)ForwardTGATTCTCTTGCCTCTTCTTG
ReverseTATGGAATCTCCTGGCTCTC
TIMP-1ForwardCTGAGAAGGGCTACCAGAG
ReverseGTCATCGAGACCCCAAGGT
TIMP-2ForwardGGACCTGACAAGGACATCG
ReverseTTCTTTCCTCCAACGTCCAG
MMP-1ForwardGATGAAAGGTGGACCAACAAT
ReverseCCAAGAGAATGGCCGAGTTC
MMP-2ForwardTGGGGGAGATTCTCACTTTG
ReverseCCATCAGCGTTCCCATACTT
MMP-14ForwardTGGGGTCATCTGCTTCTCTT
ReverseTAGGGCTCATATGCCCAAAG
Housekeeping genesPrimersSequences (5'- 3')
  GAPDHForwardCAAGTTCAACGGCACAGTCA
ReverseCATACTCAGCACCAGCATCA
  α-tubulinForwardCAATTCCATCCTCACCACC
ReverseCAACCTGTTTAAGTTAGTGTAG
  TBP (TATA-box binding protein)ForwardTGCGTTGATCTTCAGTTCTG
ReverseCTTGCTGCTAGTCTGGATTG
  ACTB (β-actin)ForwardGGTGTGATGGTGGGTATGG
ReverseGTTGGTGACAATGCCGTGTT

 

Table 3. Quantitative Indicators of Hematological Analysis of Animals of the DOX-15, DOX-10, DOX-5 Groups
 
TimeGroups
DOX-15DOX-10DOX-5Control
*DOX-15, DOX-10, DOX-5 vs. control (*P < 0.05, **P < 0.01, ***P < 0.001). GR: granulocytes; Hb: hemoglobin; Hct: hematocrit; Lym: lymphocytes; MCH: mean concentration hemoglobin; MCHC: mean corpuscular hemoglobin concentration; MCV: mean corpuscular volume; Mi: monocytes; Plt: platelets; RBCs: red blood cells; WBCs: white blood cells.
WBCs, × 109 g/L
  Starting point9.4 (7.8 - 13.7)13.3 (7.7 - 17.3)10.7 (7.6 - 12.7)9.1 (8.2 - 12.9)
  0 point6.1 (4.7 - 7.4)**10.3 (7.4 - 11.7)7.9 (5.7 - 10.1)12.2 (9.5 - 13.6)
  First month11.4 (7.7 - 15.5)13.8 (13 - 14.9)12.7 (10.3 - 12.8)10.3 (8.5 - 13.3)
  Second month6.3 (4.1 - 7.1)6.9 (4.9 - 11.3)7.9 (6.3 - 9.5)*11.2 (3.8 - 6.3)
Lym, × 109 g/L
  Starting point7.1 (4.8 - 7.9)6.2 (5 - 8.9)8.1 (6.2 - 8.2)7.1 (6.3 - 7.8)
  0 point3.8 (3 - 7.5)**6.9 (5.3 - 7.9)5.6 (4.7 - 7.8)8.9 (7.3 - 9.8)
  First month6.8 (5.9 - 8.4)10.5 (8.7 - 11.7)10 (7.2 - 10.9)7.9 (6.6 - 10.1)
  Second month3.1 (2.8 - 6)5.7 (3.8 - 7.4)5.6 (4.2 - 7.1)7.6 (2.8 - 4.4)
Mi, %
  Starting point8.9 (7 - 10.3)4.0 (0.5 - 9.9)7.5 (0.6 - 13)1.4 (0.6 - 8.1)
  0 point0.7 (0.6 - 2.6)0.6 (0.6 - 0.7)**3.1 (0.6 - 5.4)4.4 (2.9 - 7)
  First month9 (3 - 11.4)4.4 (1.2 - 12.3)4.2 (3 - 12)3.8 (3.2 - 10.4)
  Second month2.8 (1.9 - 9.5)7.3 (3.1 - 9.7)4.9 (2.8 - 9.8)8.7 (6.4 - 9.8)
GR, %
  Starting point20.9 (18.3 - 24.5)14.2 (13.4 - 21.1)14.2 (8.5 - 18.8)13.3 (9.2 - 18.8)
  0 point29.8 (24.1 - 35.8)26.7 (20.6 - 31.3)17.5 (14.5 - 20.4)19.6 (16.3 - 23.8)
  First month19 (17.6 - 38.8)17.9 (15.8 - 21.6)16.4 (10.4 - 20)15.4 (14.3 - 19.1)
  Second month12.7 (9.2 - 39.3)16.8 (14.1 - 19.4)22.80 (18.1 - 25.5)24.85 (20.5 - 28.6)
RBCs, 1012/L
  Starting point8.3 (7.4 - 8.9)8 (7.9 - 8.5)9.6 (8.7 - 9.9)9.4 (8.7 - 9.7)
  0 point8.6 (8.1 - 9.3)9.6 (9.2 - 10.6)8.8 (8.4 - 9.1)8.7 (8.2 - 9.3)
  First month8.1 (7.7 - 8.5)8.2 (6.9 - 8.8)9.7 (9.4 - 10.6)8.6 (8.3 - 9.6)
  Second month7.7 (6.8 - 8.8)8 (7.6 - 8.7)7.9 (7.7 - 8.2)7.5 (7.2 - 7.7)
Hb, g/L
  Starting point174 (156 - 189)166 (160 - 170.5)168.5 (157.5 -173.8)167 (158.5 - 170.3)
  0 point134 (128.3 -139.8)**161 (154 - 165)161 (155 - 164.3)169 (162 - 172)
  First month169 (164 - 183.5)177 (169 - 189.5)169 (164 - 171)168 (165.5 - 178.3)
  Second month154 (134 - 190.5)170 (166 - 176.5)*155.5 (152 - 160.8)156 (150.8 - 160)
Hct, %
  Starting point43.4 (38.85 - 45.47)40.9 (39.66 - 45.82)46.9 (44.8 - 48.7)44.2 (41.8 - 46.6)
  0 point42.5 (40.2 - 47.3)48.8 (46.8 - 49.2)40.1 (37.5 - 42.7)42.7 (39.1 - 44.9)
  First month39.5 (38.2 - 42.2)41.9 (39.5 - 45.4)47.9 (45.8 - 50.4)40.4 (38.7 - 44.9)
  Second month34.5 (29.2 - 43.7)38.1 (36.7 - 39.9)**35.2 (34.8 - 36.1)41.1 (33.4 - 35.3)
MCV, fL
  Starting point52 (51 - 52)51 (50 - 54)47.5 (46.7 - 51.)48 (47 - 49)
  0 point50 (50 - 50.7)51 (48 - 51.5)45 (45 - 45.7)48 (46 - 50)
  First month50 (46.5 - 51.5)50 (47.7 - 53)48 (47 - 50)47 (46.2 - 49.5)
  Second month46 (42.5 - 50)47.5 (46 - 51)44.5 (42.7 - 45)46 (45 - 46)
MCH, pg
  Starting point21 (21 - 21.2)20.2 (19.3 - 21.3)17 (16 - 18.6)17.9 (16.6 - 19.2)
  0 point15.6 (14.4 -17.4)**16.9 (14.7 - 18.2)*18.1 (17.6 - 18.9)19.2 (18.3 - 19.8)
  First month21.2 (20.3 - 21.9)21.8 (20.5 - 22.1)*17 (16 - 17.7)19.3 (18.4 - 19.9)
  Second month20.6 (19.4 - 21.7)21.7 (20.3 - 22)19.6 (19.4 - 19.4)*20.6 (20.3 - 21.7)
MCHC, g/L
  Starting point406 (401 - 412)406 (357 - 422)363 (340 - 373.8)384 (343 - 399.5)
  0 point307.5 (292.3 -350.3)*327 (306.5 - 349.5)392 (383 - 403)395.5 (368 - 403.8)
  First month437 (424.5 - 443.5)423 (414.8 - 428)351 (340 - 357)411.5 (364.3 - 430)
  Second month445 (435.5 - 457.5)446.5 (437.3 - 459.3)445.5 (439.3 -455.8)453.5 (446.5 - 462.5)
Plt, 109 g/L
  Starting point579 (566 - 649)628 (572 - 820)775.5 (689 - 862)785.5 (785 - 786)
  0 point1,722 (1,358 -1,816)***967 (852 - 1,051)709.5 (654.5 -746.3)644 (483 - 659.5)
  First month497.5 (409.8 - 626)558 (510.3 - 681)727 (593 - 820)687 (531 - 731)
  Second month512 (437 - 643)569 (482 - 592.8)550 (479.5 - 567.5)580 (564 - 616.8)